Table 2 Detail of the designed primers used for qPCR validation of the selected miRNA-target genes vis-à-vis their functions
| SN | miRNA | Target Gene | Function of Target Gene | Target gene Primer Name &Sequence (5′-3′) | Tm (°C) | Ampli-con length |
|---|---|---|---|---|---|---|
| 1 | bta-miR-9-5p | Y-Box Binding Protein 3 (YBX3) | Associated with binding of nucleic acid, activation of transcription factor, Sertoli-Sertoli cell junction related pathways | YBX3-F: ccgcaatgccggtgagattg | 62 | 187 |
| YBX3-R: gtttggaccattggccgctt | 62 | |||||
| 2 | bta-miR-9-5p | Sorting Nexin 25 (SNX25) | Phosphatidylinositol binding and type I transforming growth factor beta receptor binding. | SNX25-F: aaatgcgccaaaacccgaca | 62 | 185 |
| SNX25-R: gcatttgctcgccgttctct | 62 | |||||
| 3 | bta-miR-677 | Nuclear Receptor Subfamily 3, Group C, Member 1 (NR3C1) | As transcription factor and also as regulator of transcription factor; Mutations: generalized glucocorticoid resistance | NR3C1-F: acctacgcagtgaaatgtcagact | 62 | 162 |
| NR3C1-R: gtttctccatatttggcattgctgt | 60 | |||||
| 4 | bta-miR-677 | Transmembrane 9 Superfamily Member 3 (TM9SF3) | Regulation of gene expression, morphogenesis, and differentiation, cell cycle progression. | TM9SF3-F: cgctatggtgtgtggcactg | 62 | 170 |
| TM9SF3-R: gctgacctgacagatttcggc | 62 | |||||
| 5 | bta-miR-331-3p | Benzodiazepine Receptor (Peripheral) Associated Protein 1 (BZRAP1) | GPCR & downstream signaling of B Cell Receptor. Association with diseases: amelogenesis-imperfecta disease. | BZRAP1-F: acggctgtgctggagaactt | 62 | 182 |
| BZRAP1-R: caggcgatctcggcagatgt | 62 | |||||
| 6 | bta-miR-331-3p | Cleavage and Polyadenylation Specific Factor 2, 100 kDa (CPSF2) | Gene expression and mRNA splicing pathways; RNA binding. | CPSF2-F: cgctgctgaaccaacgtcag | 62 | 187 |
| CPSF2-R: cggtccaacaacaacaatccaaa | 60 | |||||
| 7 | bta-miR-2440 | RAB39B, Member RAS Oncogene Family (RAB39B) | Encodes a member of the Rab family of proteins that are involved in vesicular trafficking. Mutations: X-linked mental retardation. | RAB39B-F: acacgtccagccctaccaaa | 61 | 189 |
| RAB39B-R: aatagcgtctcgggctgacg | 62 | |||||
| 8 | bta-miR-2440 | Ribosomal Modification Protein RimK-Like Family Member A (RIMKLA) | Metabolism pathways and Alanine, aspartate and glutamate metabolism; glutathione synthase activity and N-acetyl-L-aspartate-L-glutamate ligase activity | RIMKLA-F: ccttcgaccaggcatgcaac | 62 | 175 |
| RIMKLA-R: tagacgctctccgcaactcc | 62 |